Bioscience Chapter Database :: 3635 Chapters Now Online

Chapter category: Gene Expression

Human, Mouse and Yeast Telomerase

This chapter appears in the following book:

Telomerases, Telomeres and Cancer

Edited by: Guido Krupp and Reza Parwaresch
ISBN: 0-306-47437-9
» Get more information about this book at landesbioscience.com «

Chapter authors:
Tara J. Moriarty and Chantal Autexier


[+] view image
Telomeres, the ends of chromosomes, and their associated proteins, maintain genomic stability.1 Intact telomeres prevent the ends of chromosomes from being degraded by exonucleases, from illegitimately recombining to produce end-to-end fusions and from activating DNA damage checkpoints.2 In most eukaryotes, telomeres consist of tandem repeats of short G-rich sequences, such as d(TTAGGG)n in humans and d(TTGGGG) in the ciliated protozoan, Tetrahymena.3-5 In certain yeast, such as Saccharomyces cerevisiae and Kluyveromyces lactis, the telomeric sequences are irregular d(TG2-3(TG)1-3) or longer d(GGATTTGATTAGGTATGTGGTGTAC), respectively. Telomeres range in size from under fifty base pairs (bp) in some ciliated protozoa, a few hundred bp in yeast, 2-15 kilobase pairs (kbp) in human to 10-60 kbp in the common laboratory mouse, Mus musculus.3,6 If conventional DNA polymerases and primases were the only enzymes involved in replicating the terminal bases of a linear DNA molecule, then chromosomes would shorten with the removal of terminal RNA primers at each round of replication (known as the end replication problem).4,7,8 Telomerase is an enzyme that compensates for this loss, and thus defines one of the mechanisms for replicating and maintaining chromosomal termini.8,9

» Access chapter for $19



Additional chapters from this book:

Telomere Maintenance in Human Cell Lines and Tumors without Telomerase

Clare L. Fasching, Roger R. Reddel

In eukaryotic organisms containing linear chromosomes, each chromosome end terminates in a specialized structure, referred to as a telomere, that contains Grich repetitive DNA.1 ...

Recombinational Telomere Elongation in the Yeast Kluyveromyces lactis

Michael J. McEachern

As detailed elsewhere in this book, the functioning of human telomeres was shown to be involved in both carcinogenesis and cellular senescence. The gradual shortening of telomeres that occu...

Telomeres without Telomerase in Saccharomyces cerevisiae

Edward J. Louis

There are two important properties of telomeres. They must be able to overcome the inability for DNA polymerases to replicate the ends of chromosomes, the endreplication problem, and they m...

Structure and Maintenance of Chromosome Ends in Plants

Jîrí Fajkus and Ulrike Zentgraf

Let us open this chapter by answering two basic questions: which features distinguish the terminal parts of plant chromosomes from their internal regions, and what is special about plant ch...

New Telomere Formation During the Process of Chromatin Diminution in the Parasitic univalens

Fritz Müller

Telomeres are specialized DNAprotein complexes at the end of all linear eukaryotic chromosomes that are essential for the maintenance of genome integrity. In the vast majority of eukaryotes...

Regulation of Telomerase Activity

JunPing Liu, Siddhartha Deb, and He Li

Essential for genomic integrity and stability within the cell, telomerase plays an important role in cell proliferation and aging. Telomerase maintains the genome with its enzy matic activi...

Telomerase and Radiosensitivity of Human Tumors

Tej K. Pandita

Telomerase is a ribonucleoprotein complex that elongates telomeres. It is ubiquitous in embryonic tissues but downregulated in most of the somatic tissues. Biochemical and genetic studies h...

Telomerase Activity in Neuroblastomas: A New Molecular Marker for Treatment

Christopher Poremba and Barbara Dockhorn Dworniczak

Neuroblastoma, a tumour derived from neural crest cells, represents the third most common pediatric cancer (accounting for approximately 710% of all childhood malignancies) and is the most com...

Telomerase in Mesothelioma: Diagnostic and Therapeutic Applications

Karl Dhaene

Malignant mesothelioma (MM) is an aggressive malignancy of the mesothelial cell (MC) lining the body cavities. In western Europe, its incidence is expected to rise till 2020 because of the wid...

Telomerase Activity in Mesenchymal Tumors

Regine Schneider Stock, Carsten Boltze, and Albert Roessner

Together with tumors of bone, soft tissue tumors form a major histogenetic class that is distinct from neoplasms of epithelial, hematopoetic, or central neurogenic origin. Although consistent ...

The Role of Telomerase DeRegulation in Keratinocyte Immortality and the Progression

E. Kenneth Parkinson

In contrast to normal keratinocytes, most advanced human head and neck squamous cell carcinomas (SCC-HNs) are immortal1 and the immortal phenotype is associated with specific forms ...

Human, Mouse and Yeast Telomerase

Tara J. Moriarty and Chantal Autexier

Telomeres, the ends of chromosomes, and their associated proteins, maintain genomic stability.1 Intact telomeres prevent the ends of chromosomes from being degraded by exonucleases,...

The Significance of Quantitative Evaluation of Telomerase Activity and hTERT mRNA Expression in Colorectal Cancers

Melissa Poggesi, Stefania Gelmini, Claudia Casini Raggi, Fabio Cianchi, Rosa Valanzano, Mario Pazzagli and Claudio Orlando

Colorectal cancer is a common tumor in western countries. In the United States, during 2000, more than 130 000 new cases of colon cancer and rectal cancer were reported1 affecting a...

Linear Plasmids in Yeasts and Filamentous Fungi

Livia Civitelli and Fiorentina Ascenzioni

Plasmids are extrachromosomal molecules that replicate independently from the genome although in some cases, when they integrate into the chromosomes, replicate as a part of the genome. Pla...

Yeast Telomerases: Structure, Mechanisms and Regulation

Neal F. Lue

Because of the ability to carry out facile genetic analysis, budding yeasts have long been used as model systems for identifying factors involved in regulating telomere structure and maintenan...

Roles for TERT and Telomerase in Cell Differentiation and Apoptosis

Mark P. Mattson, Peisu Zhang and Weiming Fu

High levels of telomerase activity are associated with cell proliferation during embryonic development and with cell transformation and cancers. In developing tissues levels of telomerase acti...

Mitochondrial Telomeres: Alternative Solutions to the End-Replication Problem

Jozef Nosek and Lubomir Tomaska

Linear and circular genomes may appear to be evolutionarily distant. However, there are numerous cases in which closely related organisms with nearly identical genomes can be found arranged ei...

Telomerase Activity as a Marker of Tumor Cell Survival to Evaluate Sensitivity of Neoplastic Cells to Cancer Treatment

Isabella Faraoni and Enzo Bonmassar

Part of this book is dedicated to the large amount of experimental data presently available on the biochemical and molecular aspects of telomerase. Therefore no details on this enzymatic funct...

DNA Primer Extension by Telomerase

Haim Manor, Yonit Haviv and Nava Baran

Telomeres are DNA-protein complexes found at the ends of linear eukaryotic chromosomes. The telomeric complexes prevent the chromosome ends from being recognized and processed as double strand...

The Makings of Telomerases

Joachim Lingner and Christian Wenz

The discovery of the cellular reverse transcriptase known as 'telomerase' in extracts from the singlecelled ciliate Tetrahymena thermophila by Carol Greider and Elizabeth...

The Biology of Telomeres in Hypotrichous Ciliates

Franziska Jonsson and Hans J. Lipps

Like other ciliated protozoa, hypotrichous ciliates, to which for example the genera Euplotes, Oxytricha or Stylonychia belong, contain two morphologi...

PNA and Oligonucleotide Inhibitors of Human Telomerase

Gérald Gavory and Shankar Balasubramanian

Telomerase is a ribonucleoprotein enzyme that maintains telomeres; the ends of eukaryotic chromosomes. Human telomerase synthesises TTAGGG tandem repeat sequences at the 3' end of the chromoso...

Potential of the Telomerase Catalytic Subunit as a Universal Tumor-Associated Antigen for Cancer Immunotherapy

Robert H. Vonderheide and William C. Hahn

Numerous recent studies in both human and animal systems have provided compelling evidence that the immune system can be manipulated to specifically recognize and kill human tumor...

RAP1 Binding and Length Regulation of Yeast Telomeres

Johan Wahlin and Marita Cohn

The gene coding for Repressor Activator Protein 1 (RAP1) is essential for S. cerevisiae cellular viability. Since it was first identified some 15 years ago, the RAP1

Telomeres in Drosophila and Other Insects

Harald Biessmann, Marika F. Walter and James M. Mason

Of the vast numbers of insect species from many orders, only a few have been investigated for telomere structure. However, these studies have revealed the presence of three different types of ...

Telomeres and Mechanisms of DNA Double Strand Break Repair

Predrag Slijepcevic

More than half a century ago, the pioneer of radiation genetics, Herman Joseph Muller, proposed that specialized structures, he termed telomeres, must be present at chromosome ends to ...

Amplification of hTERT, the Telomerase Reverse Transcriptase Gene in Human

Dawei Xu, Anju Zhang, Mi Hou, Magnus Björkholm and Astrid Gruber

Telomeres, the nucleoprotein structure consisting of tandemly repeated TTAGGG sequences and associated proteins, form protective caps on human linear chromosome ends, and are essential to main...


SIGN IN

Email:


Password:


lost password?




[ Home | Authors | Editors | Custom Books | Chapter Reprints | Subscribe | Contact | Biotoons ]